Sequence

CUGGCAAGUUGUCCUUCGGCUA

Expression details
CountSample IDExperiment title
16GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
8GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
8GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
6GSM518431MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
3GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506682Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM387519Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM518390MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM711891Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1GSM711894Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings