Sequence

CCAAGGAUGACUUGCCGGAAC

Expression details
CountSample IDExperiment title
40GSM707691Characterization of AGO1-/AGO4-associated smRNAs
12GSM707680Characterization of AGO1-/AGO4-associated smRNAs
12GSM707684Characterization of AGO1-/AGO4-associated smRNAs
11GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
8GSM707685Characterization of AGO1-/AGO4-associated smRNAs
4GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
4GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
3GSM707681Characterization of AGO1-/AGO4-associated smRNAs
2GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
2GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM154376Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM387519Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491575Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs