Sequence

CAGCCAAGGAUGACUUGCCGGAA

Expression details
CountSample IDExperiment title
11GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
3GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
3GSM707680Characterization of AGO1-/AGO4-associated smRNAs
2GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM304282ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
1GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM387516Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM387519Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM387521Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM424847Low oxygen responsive small RNAs in Arabidopsis
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4