AUGCAGCCAAGGAUGACUUGCC
| Count | Sample ID | Experiment title |
|---|---|---|
| 10 | GSM154377 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 2 | GSM253622 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM257236 | High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants |
| 1 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |