Sequence

AGCCAAGGAUGACUUGCCGGAA

Expression details
CountSample IDExperiment title
5GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana