Sequence

UGCAGCCAAGGAUGACUUGCCGA

Expression details
CountSample IDExperiment title
4GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
3GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
2GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM387520Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi