Sequence

GGCAAGUUGUCCUUGGCUACAC

Expression details
CountSample IDExperiment title
4GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
4GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM284749A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707687Characterization of AGO1-/AGO4-associated smRNAs