Sequence

GCAGCCAAGGAUGACUUGCC

Expression details
CountSample IDExperiment title
17GSM707691Characterization of AGO1-/AGO4-associated smRNAs
9GSM707685Characterization of AGO1-/AGO4-associated smRNAs
6GSM707683Characterization of AGO1-/AGO4-associated smRNAs
3GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM707679Characterization of AGO1-/AGO4-associated smRNAs
2GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM257237High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491575Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs