Sequence

CGAAAGUAGUGUGCAGCCAAG

Expression details
CountSample IDExperiment title
4GSM707691Characterization of AGO1-/AGO4-associated smRNAs
3GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings