CGAAAGUAGUGUGCAGCCAAG
| Count | Sample ID | Experiment title |
|---|---|---|
| 4 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM491568 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491572 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491573 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM518452 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM711892 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |