Sequence

CAGCCAAGGAUGACUUGCCGAUUU

Expression details
CountSample IDExperiment title
11GSM707680Characterization of AGO1-/AGO4-associated smRNAs
7GSM707681Characterization of AGO1-/AGO4-associated smRNAs
5GSM707679Characterization of AGO1-/AGO4-associated smRNAs
4GSM707689Characterization of AGO1-/AGO4-associated smRNAs
2GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM154372Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506668Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506674Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506676Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs