CAAGUUGUCCUUGGCUACACG
| Count | Sample ID | Experiment title |
|---|---|---|
| 31 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 11 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 10 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 7 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 5 | GSM118374 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 5 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM442934 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 4 | GSM506686 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 3 | GSM506684 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 3 | GSM506688 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 3 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM506659 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM506685 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM506689 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM506691 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM154377 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 1 | GSM366867 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 1 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM491567 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491570 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491571 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491572 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491575 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM506656 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506658 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506661 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506662 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506666 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506667 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506690 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM512703 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM518390 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |