Sequence

CAAGUUGUCCUUGGCUACACG

Expression details
CountSample IDExperiment title
31GSM707691Characterization of AGO1-/AGO4-associated smRNAs
11GSM707685Characterization of AGO1-/AGO4-associated smRNAs
10GSM707680Characterization of AGO1-/AGO4-associated smRNAs
7GSM707684Characterization of AGO1-/AGO4-associated smRNAs
5GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
5GSM707679Characterization of AGO1-/AGO4-associated smRNAs
4GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
4GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM707678Characterization of AGO1-/AGO4-associated smRNAs
3GSM707683Characterization of AGO1-/AGO4-associated smRNAs
2GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491575Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518390MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana