CAAGUUGUCCUUGGCUACAC
| Count | Sample ID | Experiment title |
|---|---|---|
| 3 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM154376 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 1 | GSM491573 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |