Sequence

AUCGGCAAGUUGUCCUUGGCUACA

Expression details
CountSample IDExperiment title
92GSM707689Characterization of AGO1-/AGO4-associated smRNAs
13GSM707680Characterization of AGO1-/AGO4-associated smRNAs
11GSM707688Characterization of AGO1-/AGO4-associated smRNAs
9GSM707679Characterization of AGO1-/AGO4-associated smRNAs
9GSM707686Characterization of AGO1-/AGO4-associated smRNAs
6GSM707678Characterization of AGO1-/AGO4-associated smRNAs
6GSM707681Characterization of AGO1-/AGO4-associated smRNAs
5GSM707684Characterization of AGO1-/AGO4-associated smRNAs
5GSM707687Characterization of AGO1-/AGO4-associated smRNAs
3GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM707685Characterization of AGO1-/AGO4-associated smRNAs
2GSM366865Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
2GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
1GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506668Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506670Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs