Sequence

AUCGGCAAGUUGUCCUUGGCUA

Expression details
CountSample IDExperiment title
7GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
2GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM149081Small RNAs in Arabidopsis thaliana and its RISC complexes
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM707688Characterization of AGO1-/AGO4-associated smRNAs