Sequence

UCUCGGAUUCGCUUGGUGCAG

Expression details
CountSample IDExperiment title
2GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi