Sequence

GCUCCCGUCUUGUAUCAACUGAAU

Expression details
CountSample IDExperiment title
61GSM707687Characterization of AGO1-/AGO4-associated smRNAs
20GSM707689Characterization of AGO1-/AGO4-associated smRNAs
14GSM707688Characterization of AGO1-/AGO4-associated smRNAs
2GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
2GSM707686Characterization of AGO1-/AGO4-associated smRNAs
1GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
1GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506675Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518467small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs