GCUCCCGUCUUGUAUCAACUGAAU
| Count | Sample ID | Experiment title |
|---|---|---|
| 61 | GSM707687 | Characterization of AGO1-/AGO4-associated smRNAs |
| 20 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 14 | GSM707688 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM366868 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
| 2 | GSM707686 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM253624 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM342999 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 1 | GSM491570 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM506675 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM518467 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |