Sequence

CUCCCGUCUUGUAUCAACUGAAU

Expression details
CountSample IDExperiment title
3GSM707685Characterization of AGO1-/AGO4-associated smRNAs
2GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
2GSM707683Characterization of AGO1-/AGO4-associated smRNAs
2GSM707687Characterization of AGO1-/AGO4-associated smRNAs
2GSM707691Characterization of AGO1-/AGO4-associated smRNAs
1GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518464small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM707688Characterization of AGO1-/AGO4-associated smRNAs
1GSM707689Characterization of AGO1-/AGO4-associated smRNAs
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs