Sequence

CCGUCUUGUAUCAACUGAAU

Expression details
CountSample IDExperiment title
8GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
6GSM707679Characterization of AGO1-/AGO4-associated smRNAs
6GSM707680Characterization of AGO1-/AGO4-associated smRNAs
5GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM707681Characterization of AGO1-/AGO4-associated smRNAs
2GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
2GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM118373High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs