Sequence

UGAAUGAUGCCUGGCUCGAGAC

Expression details
CountSample IDExperiment title
4GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
4GSM518431MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis