Sequence

AUGUCGGACCAGGCUUCAUUC

Expression details
CountSample IDExperiment title
3GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM518431MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues