Sequence

UGACGUCGGACCAGGCUUCAUUCCC

Expression details
CountSample IDExperiment title
1GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518457small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues