Sequence

GUCGGACCAGGCUUCAUUCCCCU

Expression details
CountSample IDExperiment title
1GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM424743smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
1GSM424847Low oxygen responsive small RNAs in Arabidopsis
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM707686Characterization of AGO1-/AGO4-associated smRNAs
1GSM707689Characterization of AGO1-/AGO4-associated smRNAs