GGAAUGUUGUCUGGCACGAGGCCCU
| Count | Sample ID | Experiment title |
|---|---|---|
| 1 | GSM366870 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
| 1 | GSM415798 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM456945 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |