Sequence

UGUCGUCGGACCAGGCUUCAUUCC

Expression details
CountSample IDExperiment title
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518451small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518465small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues