Sequence

UCGUCGGACCAGGCUUCAUUC

Expression details
CountSample IDExperiment title
3GSM707683Characterization of AGO1-/AGO4-associated smRNAs
2GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518431MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518449small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518450small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518461small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs