Sequence

GGGGACUGUUGUCUGGCUCGAGGA

Expression details
CountSample IDExperiment title
2GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518465small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707689Characterization of AGO1-/AGO4-associated smRNAs