Sequence

GGGACUGUUGUCUGGCUCGAGGAC

Expression details
CountSample IDExperiment title
2GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM284750A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0