Sequence

GGGACUGUUGUCUGGCUCGAG

Expression details
CountSample IDExperiment title
2GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
2GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518438small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518441small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518442small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518449small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605660Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs