Sequence

AGGGGACUGUUGUCUGGCUC

Expression details
CountSample IDExperiment title
4GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
4GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM506682Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
2GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM304284ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
1GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM605660Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0