Sequence

GGACUGUUGUCUGGCUCGAG

Expression details
CountSample IDExperiment title
10GSM707678Characterization of AGO1-/AGO4-associated smRNAs
7GSM707680Characterization of AGO1-/AGO4-associated smRNAs
6GSM707679Characterization of AGO1-/AGO4-associated smRNAs
5GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
4GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
4GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
4GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
3GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
3GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
3GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM707681Characterization of AGO1-/AGO4-associated smRNAs
2GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM284749A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM284750A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM605660Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM154368Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM277609Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM385393Small RNAs in Arabidopsis hybrid siliques
1GSM415795Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518441small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518449small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518455small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM554063Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs