Sequence

GACUGUUGUCUGGCUCGAGGAC

Expression details
CountSample IDExperiment title
24GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
23GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
23GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
18GSM605660Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
9GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
6GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
6GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
6GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
5GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
5GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
4GSM707687Characterization of AGO1-/AGO4-associated smRNAs
3GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM491575Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM491579Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
3GSM707680Characterization of AGO1-/AGO4-associated smRNAs
2GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM284749A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM284750A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM707678Characterization of AGO1-/AGO4-associated smRNAs
2GSM707689Characterization of AGO1-/AGO4-associated smRNAs
1GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
1GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM277609Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM415785Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415789Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415790Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415794Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518461small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM707688Characterization of AGO1-/AGO4-associated smRNAs
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs
1GSM711891Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings