Sequence

UUUAGUCACUUUCACUGCAUUA

Expression details
CountSample IDExperiment title
3GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM707683Characterization of AGO1-/AGO4-associated smRNAs
2GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM366869Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs