Sequence

UUGAAAGUGACUACAUCGGGGUU

Expression details
CountSample IDExperiment title
56GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
23GSM707685Characterization of AGO1-/AGO4-associated smRNAs
22GSM707691Characterization of AGO1-/AGO4-associated smRNAs
19GSM707683Characterization of AGO1-/AGO4-associated smRNAs
15GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
15GSM707688Characterization of AGO1-/AGO4-associated smRNAs
13GSM491575Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
12GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
12GSM711891Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
11GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
11GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
11GSM707684Characterization of AGO1-/AGO4-associated smRNAs
10GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
8GSM707682Characterization of AGO1-/AGO4-associated smRNAs
7GSM491579Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
5GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
5GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
5GSM707680Characterization of AGO1-/AGO4-associated smRNAs
5GSM707681Characterization of AGO1-/AGO4-associated smRNAs
5GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
4GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
4GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
4GSM707678Characterization of AGO1-/AGO4-associated smRNAs
4GSM707679Characterization of AGO1-/AGO4-associated smRNAs
3GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
3GSM506677Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM707686Characterization of AGO1-/AGO4-associated smRNAs
3GSM707690Characterization of AGO1-/AGO4-associated smRNAs
3GSM711894Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
2GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
2GSM253625Small RNAs in four Argonaute complexes in Arabidopsis
2GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM506670Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707687Characterization of AGO1-/AGO4-associated smRNAs
2GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1GSM118373High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM149080Small RNAs in Arabidopsis thaliana and its RISC complexes
1GSM277609Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM415789Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506671Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506672Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518438small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings