Sequence

UUGAAAGUGACUACAUCGGGG

Expression details
CountSample IDExperiment title
45749GSM707685Characterization of AGO1-/AGO4-associated smRNAs
39414GSM707691Characterization of AGO1-/AGO4-associated smRNAs
37603GSM149080Small RNAs in Arabidopsis thaliana and its RISC complexes
34703GSM707683Characterization of AGO1-/AGO4-associated smRNAs
30493GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
29798GSM711891Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
27564GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
23355GSM711894Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
23150GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
16235GSM707682Characterization of AGO1-/AGO4-associated smRNAs
15764GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
13767GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
13083GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
12615GSM707684Characterization of AGO1-/AGO4-associated smRNAs
10012GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
9513GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
8920GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
8853GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
8781GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
8773GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
8330GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
8165GSM491575Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
8151GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
7717GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
7695GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
7661GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
7570GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
7208GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
6702GSM707690Characterization of AGO1-/AGO4-associated smRNAs
6690GSM707679Characterization of AGO1-/AGO4-associated smRNAs
6471GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
5844GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
5419GSM707681Characterization of AGO1-/AGO4-associated smRNAs
5404GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
5336GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
5162GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4976GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
4646GSM707678Characterization of AGO1-/AGO4-associated smRNAs
4552GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
4493GSM366869Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
4474GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
4472GSM491579Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
4117GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3769GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
3333GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3254GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
3199GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3166GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2947GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2930GSM707680Characterization of AGO1-/AGO4-associated smRNAs
2798GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
2790GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2767GSM366865Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
2747GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2727GSM605660Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2610GSM506673Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2532GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2469GSM491569Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2454GSM304283ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
2432GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2383GSM277609Highly integrated single base resolution maps of the epigenome in Arabidopsis
2285GSM506670Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2256GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2249GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2245GSM506669Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2207GSM506672Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2149GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2145GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2047GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2023GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1934GSM506677Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1931GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1919GSM506674Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1895GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1798GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1722GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1701GSM506682Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1597GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1563GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1528GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1449GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1436GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1428GSM518389MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1399GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1385GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1384GSM506671Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1311GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1304GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1269GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1253GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1222GSM506668Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1047GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
990GSM506675Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
980GSM118373High-throughput sequencing of small RNAs from Arabidopsis thaliana
917GSM518431MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
871GSM506678Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
846GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
835GSM424848Low oxygen responsive small RNAs in Arabidopsis
834GSM506676Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
819GSM304285ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
727GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
723GSM554064Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
659GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
637GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
588GSM424847Low oxygen responsive small RNAs in Arabidopsis
520GSM304282ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
502GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
472GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
442GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
246GSM149079Small RNAs in Arabidopsis thaliana and its RISC complexes
245GSM424744smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
220GSM707688Characterization of AGO1-/AGO4-associated smRNAs
209GSM424742smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
203GSM154363Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
201GSM707686Characterization of AGO1-/AGO4-associated smRNAs
196GSM304284ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
174GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
161GSM707689Characterization of AGO1-/AGO4-associated smRNAs
146GSM424743smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
138GSM257236High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
132GSM154336Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
132GSM424745smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
131GSM518390MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
129GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
128GSM121454Small RNA identification in Arabidopsis thaliana using 454 data
119GSM154367Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
109GSM707687Characterization of AGO1-/AGO4-associated smRNAs
106GSM154375Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
103GSM257235High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
95GSM554063Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
91GSM154362Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
90GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
86GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
74GSM154370Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
73GSM253625Small RNAs in four Argonaute complexes in Arabidopsis
39GSM253623Small RNAs in four Argonaute complexes in Arabidopsis
37GSM154372Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
36GSM154365Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
35GSM121457Small RNA identification in Arabidopsis thaliana using 454 data
35GSM154364Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
31GSM387515Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
31GSM518392MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
29GSM121453Small RNA identification in Arabidopsis thaliana using 454 data
21GSM121456Small RNA identification in Arabidopsis thaliana using 454 data
13GSM257237High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
11GSM154361Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
11GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
9GSM387517Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
7GSM121455Small RNA identification in Arabidopsis thaliana using 454 data
7GSM154376Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
6GSM387520Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
5GSM154368Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
5GSM387513Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
5GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
4GSM387521Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
3GSM385396Small RNAs in Arabidopsis hybrid siliques
2GSM154374Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
2GSM385393Small RNAs in Arabidopsis hybrid siliques
2GSM387522Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284749A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284750A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM385395Small RNAs in Arabidopsis hybrid siliques
1GSM387516Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM387519Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM415783Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415784Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415785Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415787Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415788Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415789Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415790Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415791Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415792Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415793Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415795Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415796Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415797Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415800Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415801Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415802Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518391MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518438small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518439small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518440small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518441small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518442small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518449small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518450small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518451small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518455small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518457small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518458small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518459small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518461small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518464small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518465small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518467small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues