UUAGUCACUUUCACUGCAUUAAUC
| Count | Sample ID | Experiment title |
|---|---|---|
| 7 | GSM506668 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 5 | GSM506679 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 5 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM506671 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 4 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM506670 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 3 | GSM506672 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM506673 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM506675 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM366867 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 1 | GSM415798 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415799 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM491571 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM506669 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506674 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506676 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506677 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506678 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM518432 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 1 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707688 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM711894 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |