Sequence

UUAGUCACUUUCACUGCAUU

Expression details
CountSample IDExperiment title
43GSM707685Characterization of AGO1-/AGO4-associated smRNAs
10GSM707683Characterization of AGO1-/AGO4-associated smRNAs
8GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
8GSM707684Characterization of AGO1-/AGO4-associated smRNAs
8GSM707691Characterization of AGO1-/AGO4-associated smRNAs
6GSM707678Characterization of AGO1-/AGO4-associated smRNAs
6GSM707679Characterization of AGO1-/AGO4-associated smRNAs
6GSM707681Characterization of AGO1-/AGO4-associated smRNAs
6GSM707682Characterization of AGO1-/AGO4-associated smRNAs
5GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
5GSM707690Characterization of AGO1-/AGO4-associated smRNAs
4GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
3GSM707680Characterization of AGO1-/AGO4-associated smRNAs
2GSM277609Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM491569Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM707689Characterization of AGO1-/AGO4-associated smRNAs