Sequence

UGGUUUAGUCACUUUCACUGCAUU

Expression details
CountSample IDExperiment title
8GSM707686Characterization of AGO1-/AGO4-associated smRNAs
7GSM707681Characterization of AGO1-/AGO4-associated smRNAs
7GSM707688Characterization of AGO1-/AGO4-associated smRNAs
5GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
3GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
3GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
2GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM707689Characterization of AGO1-/AGO4-associated smRNAs
2GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings