Sequence

UGAAAGUGACUACAUCGGGGU

Expression details
CountSample IDExperiment title
110739GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
32059GSM707685Characterization of AGO1-/AGO4-associated smRNAs
29537GSM707691Characterization of AGO1-/AGO4-associated smRNAs
25075GSM707683Characterization of AGO1-/AGO4-associated smRNAs
17322GSM707682Characterization of AGO1-/AGO4-associated smRNAs
14984GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
12449GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
11624GSM707684Characterization of AGO1-/AGO4-associated smRNAs
6110GSM554064Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
5809GSM707690Characterization of AGO1-/AGO4-associated smRNAs
5332GSM149080Small RNAs in Arabidopsis thaliana and its RISC complexes
5225GSM707679Characterization of AGO1-/AGO4-associated smRNAs
5095GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
4961GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
4888GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
4868GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
4854GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
4593GSM118373High-throughput sequencing of small RNAs from Arabidopsis thaliana
4347GSM707681Characterization of AGO1-/AGO4-associated smRNAs
4271GSM518389MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
4225GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
4011GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
3774GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
3613GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
3535GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3449GSM707678Characterization of AGO1-/AGO4-associated smRNAs
3351GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3104GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3056GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2912GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2838GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
2735GSM366865Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
2716GSM366869Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
2714GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
2431GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
2268GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1913GSM491575Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1787GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1770GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1710GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1645GSM506669Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1545GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1511GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1498GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1487GSM506673Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1464GSM506674Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1417GSM506672Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1406GSM149079Small RNAs in Arabidopsis thaliana and its RISC complexes
1357GSM506677Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1351GSM506670Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1295GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1289GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1267GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1202GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1126GSM387515Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1117GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1077GSM506682Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1062GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1059GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1039GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
990GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
943GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
847GSM506668Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
843GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
835GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
731GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
702GSM711894Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
663GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
651GSM711891Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
617GSM506675Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
600GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
592GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
587GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
569GSM506678Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
548GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
532GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
506GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
496GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
434GSM304282ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
430GSM304285ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
427GSM491579Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
424GSM387517Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
415GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
393GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
341GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
280GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
270GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
268GSM424744smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
267GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
243GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
230GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
211GSM707686Characterization of AGO1-/AGO4-associated smRNAs
209GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
206GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
185GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
177GSM491569Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
174GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
174GSM707688Characterization of AGO1-/AGO4-associated smRNAs
171GSM277609Highly integrated single base resolution maps of the epigenome in Arabidopsis
164GSM506671Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
162GSM605660Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
161GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
161GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
151GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
149GSM424745smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
148GSM518392MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
142GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
140GSM304283ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
133GSM707689Characterization of AGO1-/AGO4-associated smRNAs
131GSM424742smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
128GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
124GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
121GSM154370Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
109GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
109GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
108GSM154336Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
102GSM154367Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
102GSM506676Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
99GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
92GSM707687Characterization of AGO1-/AGO4-associated smRNAs
89GSM304284ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
88GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
85GSM424743smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
81GSM154375Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
81GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
80GSM154363Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
75GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
73GSM518390MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
72GSM154376Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
72GSM518431MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
67GSM154372Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
66GSM121454Small RNA identification in Arabidopsis thaliana using 454 data
65GSM424848Low oxygen responsive small RNAs in Arabidopsis
51GSM253625Small RNAs in four Argonaute complexes in Arabidopsis
50GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
43GSM554063Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
39GSM424847Low oxygen responsive small RNAs in Arabidopsis
37GSM257236High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
34GSM121457Small RNA identification in Arabidopsis thaliana using 454 data
34GSM154362Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
30GSM154374Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
28GSM518391MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
27GSM257235High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
23GSM154364Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
23GSM154365Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
23GSM387520Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
20GSM387521Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
20GSM387522Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
19GSM121453Small RNA identification in Arabidopsis thaliana using 454 data
17GSM154368Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
16GSM154361Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
12GSM121456Small RNA identification in Arabidopsis thaliana using 454 data
12GSM387519Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
11GSM121455Small RNA identification in Arabidopsis thaliana using 454 data
10GSM385396Small RNAs in Arabidopsis hybrid siliques
6GSM257237High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
6GSM387514Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
5GSM253623Small RNAs in four Argonaute complexes in Arabidopsis
5GSM387513Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
4GSM149081Small RNAs in Arabidopsis thaliana and its RISC complexes
4GSM385395Small RNAs in Arabidopsis hybrid siliques
4GSM387518Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
3GSM385394Small RNAs in Arabidopsis hybrid siliques
2GSM387516Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284749A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284750A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM385393Small RNAs in Arabidopsis hybrid siliques
1GSM415783Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415784Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415785Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415787Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415789Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415790Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415791Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415792Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415796Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415797Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518438small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518439small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518440small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518441small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518442small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518449small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518450small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518451small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518455small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518457small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518458small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518459small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518461small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518464small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518465small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518467small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis