UCAAUGCAUUGAAAGUGACUACAU
| Count | Sample ID | Experiment title |
|---|---|---|
| 41 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 17 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 12 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 10 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 8 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 8 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 6 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 5 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707688 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707686 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707687 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM415799 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM442934 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM506674 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |