Sequence

UCAAUGCAUUGAAAGUGACUACA

Expression details
CountSample IDExperiment title
6GSM707691Characterization of AGO1-/AGO4-associated smRNAs
5GSM707685Characterization of AGO1-/AGO4-associated smRNAs
4GSM707690Characterization of AGO1-/AGO4-associated smRNAs
2GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM506668Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518465small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM707683Characterization of AGO1-/AGO4-associated smRNAs
1GSM707689Characterization of AGO1-/AGO4-associated smRNAs