UCAAUGCAUUGAAAGUGACU
| Count | Sample ID | Experiment title |
|---|---|---|
| 14801 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 9007 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4766 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3981 | GSM506684 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 3858 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3032 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2830 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2372 | GSM506691 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2202 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2082 | GSM366866 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 1915 | GSM506688 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1886 | GSM554065 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 1696 | GSM518432 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 1464 | GSM366867 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 1423 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1417 | GSM366865 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 1395 | GSM554064 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 1348 | GSM506664 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1308 | GSM506689 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1265 | GSM366870 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
| 1249 | GSM506679 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1244 | GSM506685 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1238 | GSM506681 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1225 | GSM506683 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1177 | GSM342999 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 1141 | GSM506686 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1053 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1005 | GSM506676 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 972 | GSM343001 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 967 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 959 | GSM366868 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
| 872 | GSM506674 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 853 | GSM506687 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 846 | GSM506671 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 841 | GSM506661 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 814 | GSM506673 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 798 | GSM506669 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 770 | GSM506682 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 766 | GSM343000 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 751 | GSM366869 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
| 747 | GSM506660 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 698 | GSM506670 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 661 | GSM506672 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 636 | GSM506677 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 627 | GSM506690 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 618 | GSM506665 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 549 | GSM506663 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 516 | GSM506680 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 502 | GSM506657 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 501 | GSM506656 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 476 | GSM506659 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 437 | GSM554062 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 401 | GSM506668 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 386 | GSM506675 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 377 | GSM343004 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 332 | GSM343002 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 325 | GSM506658 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 317 | GSM506662 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 317 | GSM506667 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 293 | GSM343005 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 291 | GSM554063 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 255 | GSM304282 | ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing |
| 228 | GSM506678 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 176 | GSM506666 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 135 | GSM154377 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 103 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 91 | GSM707689 | Characterization of AGO1-/AGO4-associated smRNAs |
| 79 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 77 | GSM304283 | ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing |
| 77 | GSM304284 | ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing |
| 75 | GSM442934 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 69 | GSM707686 | Characterization of AGO1-/AGO4-associated smRNAs |
| 66 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 49 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 46 | GSM118374 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 41 | GSM304285 | ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing |
| 41 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 33 | GSM253622 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 33 | GSM707688 | Characterization of AGO1-/AGO4-associated smRNAs |
| 30 | GSM277608 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 30 | GSM387513 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 30 | GSM491570 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 29 | GSM277611 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 28 | GSM118375 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 28 | GSM387517 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 26 | GSM518429 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 26 | GSM707687 | Characterization of AGO1-/AGO4-associated smRNAs |
| 20 | GSM118373 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 19 | GSM118372 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 18 | GSM149080 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
| 18 | GSM491572 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 15 | GSM491567 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 13 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 12 | GSM491571 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 11 | GSM387515 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 10 | GSM387514 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 10 | GSM387520 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 10 | GSM491573 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 9 | GSM154375 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 9 | GSM491569 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 8 | GSM149079 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
| 8 | GSM491568 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 7 | GSM154374 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 7 | GSM387521 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 7 | GSM491574 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 7 | GSM491575 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 7 | GSM491577 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 7 | GSM711892 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 6 | GSM605658 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 6 | GSM605659 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 6 | GSM605661 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 6 | GSM605664 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 6 | GSM711894 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 5 | GSM387516 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 4 | GSM154363 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 4 | GSM277609 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 4 | GSM387519 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 4 | GSM491578 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 4 | GSM605662 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 4 | GSM605665 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 4 | GSM711891 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 4 | GSM711895 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 3 | GSM154364 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 3 | GSM277610 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 3 | GSM387518 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 3 | GSM491579 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 3 | GSM605660 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 2 | GSM154336 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 2 | GSM154365 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 2 | GSM154367 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 2 | GSM154370 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 2 | GSM154372 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 2 | GSM154376 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 2 | GSM253624 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 2 | GSM424742 | smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf |
| 1 | GSM121453 | Small RNA identification in Arabidopsis thaliana using 454 data |
| 1 | GSM121457 | Small RNA identification in Arabidopsis thaliana using 454 data |
| 1 | GSM154361 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 1 | GSM154362 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 1 | GSM253625 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM257236 | High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants |
| 1 | GSM284747 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM284748 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM284749 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM284750 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM387522 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 1 | GSM415783 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415784 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415785 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415786 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415787 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415788 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415789 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415790 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415791 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415792 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415796 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415798 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415799 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM424743 | smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf |
| 1 | GSM456944 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
| 1 | GSM456945 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
| 1 | GSM512702 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM512703 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM518440 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518444 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518446 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518447 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518448 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518453 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518458 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518461 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518462 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518466 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |