Sequence

UCAACCCUGGUUUAGUCACUUUC

Expression details
CountSample IDExperiment title
24GSM707685Characterization of AGO1-/AGO4-associated smRNAs
13GSM707691Characterization of AGO1-/AGO4-associated smRNAs
4GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
4GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
3GSM707679Characterization of AGO1-/AGO4-associated smRNAs
3GSM707682Characterization of AGO1-/AGO4-associated smRNAs
3GSM707684Characterization of AGO1-/AGO4-associated smRNAs
2GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM506673Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
2GSM707680Characterization of AGO1-/AGO4-associated smRNAs
2GSM707683Characterization of AGO1-/AGO4-associated smRNAs
1GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506671Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506672Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518465small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs