UCAACCCUGGUUUAGUCACUUUC
| Count | Sample ID | Experiment title |
|---|---|---|
| 24 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 13 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 4 | GSM711892 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 3 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM277611 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 2 | GSM506673 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 2 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM118372 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 1 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM491573 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM506659 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506671 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506672 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM518465 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |