GUCACUUUCACUGCAUUAAU
| Count | Sample ID | Experiment title |
|---|---|---|
| 12 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 10 | GSM506684 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 10 | GSM506690 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 9 | GSM554065 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 7 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 6 | GSM506664 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 6 | GSM506666 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 5 | GSM506677 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 5 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM506672 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 3 | GSM343002 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 3 | GSM506669 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 3 | GSM506678 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 3 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM343001 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 2 | GSM343005 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 2 | GSM506667 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM506670 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM506680 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM506685 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM554063 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 1 | GSM343004 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 1 | GSM415796 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415798 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM506656 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506659 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506660 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506671 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506683 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506686 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506688 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506691 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM554064 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 1 | GSM605658 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 1 | GSM605659 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 1 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |