GAAAGUGACUACAUCGGGGUU
| Count | Sample ID | Experiment title |
|---|---|---|
| 15 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 8 | GSM253622 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 8 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 8 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 7 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM711891 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 1 | GSM149080 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
| 1 | GSM277608 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 1 | GSM277609 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 1 | GSM415792 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415796 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM491570 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491571 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491572 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491575 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM506657 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM512702 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM512703 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM518431 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 1 | GSM518444 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518445 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518447 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518462 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518463 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |