Sequence

GAAAGUGACUACAUCGGGGU

Expression details
CountSample IDExperiment title
364GSM707685Characterization of AGO1-/AGO4-associated smRNAs
324GSM707691Characterization of AGO1-/AGO4-associated smRNAs
240GSM707683Characterization of AGO1-/AGO4-associated smRNAs
193GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
179GSM707682Characterization of AGO1-/AGO4-associated smRNAs
117GSM707690Characterization of AGO1-/AGO4-associated smRNAs
86GSM707684Characterization of AGO1-/AGO4-associated smRNAs
43GSM491575Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
41GSM707679Characterization of AGO1-/AGO4-associated smRNAs
35GSM707678Characterization of AGO1-/AGO4-associated smRNAs
35GSM707681Characterization of AGO1-/AGO4-associated smRNAs
27GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
25GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
22GSM707680Characterization of AGO1-/AGO4-associated smRNAs
21GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
19GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
18GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
16GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
15GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
14GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
13GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
13GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
13GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
12GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
11GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
11GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
10GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
8GSM711891Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
7GSM149080Small RNAs in Arabidopsis thaliana and its RISC complexes
7GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
7GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
7GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
7GSM711894Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
6GSM253625Small RNAs in four Argonaute complexes in Arabidopsis
5GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
5GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
5GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
4GSM121454Small RNA identification in Arabidopsis thaliana using 454 data
4GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
4GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
3GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
3GSM277609Highly integrated single base resolution maps of the epigenome in Arabidopsis
3GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
3GSM707688Characterization of AGO1-/AGO4-associated smRNAs
3GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
2GSM366869Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
2GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM506670Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506673Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
2GSM707686Characterization of AGO1-/AGO4-associated smRNAs
1GSM118373High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM121456Small RNA identification in Arabidopsis thaliana using 454 data
1GSM154364Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
1GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284749A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM304285ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
1GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM415784Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415789Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415790Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415791Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415792Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518431MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518440small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518442small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518449small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518455small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518467small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM554064Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM707687Characterization of AGO1-/AGO4-associated smRNAs