CCCUGGUUUAGUCACUUUCACU
| Count | Sample ID | Experiment title |
|---|---|---|
| 3 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM253625 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 2 | GSM343001 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 2 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM118374 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 1 | GSM506659 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |