Sequence

CCCUGGUUUAGUCACUUUCACU

Expression details
CountSample IDExperiment title
3GSM707681Characterization of AGO1-/AGO4-associated smRNAs
2GSM253625Small RNAs in four Argonaute complexes in Arabidopsis
2GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi