Sequence

CCCUGGUUUAGUCACUUUCA

Expression details
CountSample IDExperiment title
1GSM253623Small RNAs in four Argonaute complexes in Arabidopsis
1GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM506668Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi