Sequence

CAUUGAAAGUGACUACAUCGG

Expression details
CountSample IDExperiment title
5GSM707691Characterization of AGO1-/AGO4-associated smRNAs
4GSM387515Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
4GSM707685Characterization of AGO1-/AGO4-associated smRNAs
2GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM491579Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM707690Characterization of AGO1-/AGO4-associated smRNAs
1GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
1GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings