Sequence

CAAUGCAUUGAAAGUGACUAC

Expression details
CountSample IDExperiment title
12GSM707685Characterization of AGO1-/AGO4-associated smRNAs
3GSM707682Characterization of AGO1-/AGO4-associated smRNAs
3GSM707690Characterization of AGO1-/AGO4-associated smRNAs
2GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707679Characterization of AGO1-/AGO4-associated smRNAs
2GSM707684Characterization of AGO1-/AGO4-associated smRNAs
2GSM707691Characterization of AGO1-/AGO4-associated smRNAs
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707683Characterization of AGO1-/AGO4-associated smRNAs