Sequence

AUUGAAAGUGACUACAUCGGGGU

Expression details
CountSample IDExperiment title
3GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
2GSM149080Small RNAs in Arabidopsis thaliana and its RISC complexes
2GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM415792Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM707688Characterization of AGO1-/AGO4-associated smRNAs
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs